rs7148380 chr14:22392043 A>G
- Sequence
aacactggagggcaatgctggacc[A/G]gccaaagcactctaggtgctccgc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte HepG2 (hepatoblastoma) sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.15 | 0.57 | 1.59 | |||
| foreskin keratinocyte | 0.39 | n/a | 2.50 | |||
| HepG2 (hepatoblastoma) | 0.69 | 0.10 | 1.71 | |||
| sigmoid colon | -1.26 | 1.56 | 1.00 |
Items per page:
1 – 4 of 4