rs715192 chr17:15155208 G>C
- Sequence
aggatttagtaaagcagaagctgg[G/C]aagggaagtggtttacaggcaact
- ASB in cell types
- periferal blood macrophages monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.03 | -1.36 | 2.17 | -1.31 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
