rs71578227 chr7:127392599 C>T
- Sequence
tttcaggaaactttattaagtcag[C/T]ctctcttttactctgtcgccccct
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.90 | 0.10 | 1.53 | |||
| HEK293 (embryonic kidney) | -0.28 | 0.94 | 1.95 | |||
| A549 (lung carcinoma) | -0.38 | 0.84 | 1.96 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg