rs7160938 chr14:32209812 C>T
- Sequence
tgttcattttctgttgatttctgc[C/T]ttttattatttcctcccttttgtt
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.78 | -0.07 | 1.70 | |||
| HEK293 (embryonic kidney) | -0.10 | 0.48 | 1.60 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Liver, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid