rs7167150 chr15:57866409 G>T
- Sequence
ttctgttgggttctagactgtttt[G/T]caaactatccgtgtccaagaacca
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) neural progenitors KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.23 | 0.65 | 2.00 | |||
| A549 (lung carcinoma) | 0.57 | 0.69 | 1.13 | |||
| neural progenitors | -1.80 | 1.62 | 1.33 | |||
| KMS-11 | 2.18 | -1.87 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), obesity with early age of onset (age >2), salmonella-induced pyroptosis, total cholesterol