rs7168044 chr15:70258854 T>C
- Sequence
accagccctggaagcctgctgtgc[T/C]cttggggccccaaaggcagagggc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.44 | 0.97 | 1.54 | |||
| K562 (myelogenous leukemia) | 0.17 | 0.52 | 2.00 |
Items per page:
1 – 2 of 2