rs7170758 chr15:85531140 A>G
- Sequence
ctcccaaagtgctgggattacagc[A/G]tgagtcatcgcgcctggcctaagt
- ASB in cell types
- coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | 1.50 | -1.75 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid