rs7174643 chr15:73387960 A>C
- Sequence
gtgattccggttatgtgcctgtca[A/C]ggtcaccgcgctgcacaaaactgt
- ASB in cell types
- heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| heart left ventricle | -1.53 | 1.60 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, autism, comorbid depressive syndrome and alcohol dependence, late onset alzheimers disease, maternal transmission distortion, paternal transmission distortion, primary rhegmatogenous retinal detachment, tetrology of fallot, transmission distortion, waist hip ratio