rs717568 chr12:4579554 A>T
- Sequence
aatgaatcactccccctggagtta[A/T]gcaaggaggctgcatgtggactgg
- ASB in cell types
- HCPEpiC (choroid plexus epithelial cells) IPSC-derived bipolar neuron bipolar neuron GM23338
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.17 | -0.28 | 1.27 | -1.26 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
