rs718050 chr20:50580393 A>G
- Sequence
gttaacaaccattattgagtacct[A/G]ttgatatgtgtggtgtactgagtt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia) HEK293 (embryonic kidney) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.48 | 1.10 | 4.15 | |||
| K562 (myelogenous leukemia) | 0.62 | -0.18 | 2.00 | |||
| HEK293 (embryonic kidney) | -0.12 | 0.54 | 1.98 | |||
| RWPE1 (prostate epithelial cells) | 0.98 | -0.98 | 1.00 |
Items per page:
1 – 4 of 4