rs718766 chr7:121385448 T>C
- Sequence
agccaccacaatgtcgctggacaa[T/C]gaaacactgcagctggaaagagcg
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- FOXK2_HUMAN ENL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.49 | n/a | 1.33 | n/a | n/a | |||
| ENL_HUMAN | -1.38 | 1.17 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bone thickness, bone strength, osteoporotic fracture risk, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), total body bone mineral density (bmd)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg