rs7193705 chr16:66344747 T>A
- Sequence
ccagtgctgccatctagtggtgga[T/A]ccgatatagtagccattagtcatt
- ASB in cell types
- A549 (lung carcinoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.32 | -0.45 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.52 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, body mass index (bmi), chronic kidney disease, ldl cholesterol change with statins, total cholesterol change with statins