rs7198588 chr16:77236247 C>A
- Sequence
tgacgccatgcaatatgttcaggg[C/A]acaccagagggcgctacggcttcg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) epidermal keratinocytes
- ASB for transcription factors
- SMAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD4_HUMAN | 2.61 | -0.06 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), late onset alzheimers disease, waist hip ratio