rs7199727 chr16:84013907 C>A
- Sequence
agcatcagaatttaatctaacagc[C/A]cagaccagggagtgtgagggagga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.13 | 0.86 | 1.73 | |||
| HepG2 (hepatoblastoma) | -0.32 | 0.80 | 2.00 |
Items per page:
1 – 2 of 2