rs720295 chr10:71837595 C>T
- Sequence
catggctaccagctccactgactg[C/T]gcagagcccgaggccctcaggcca
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-BR-3 (breast adenocarcinoma) | 1.38 | n/a | 2.33 | |||
| K562 (myelogenous leukemia) | 0.32 | 0.42 | 1.33 |
Items per page:
1 – 2 of 2