rs7209435 chr17:63635604 T>C
- Sequence
ttctaggaaagatagggtaagagg[T/C]agtgcggggaagatgttggggaga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.06 | 0.55 | 1.82 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
PheWAS abnormal chest sounds, absent or infrequent menstruation, adrenal hyperfunction, allergies, other, anal and rectal polyp, arteritis nos, atrial fibrillation & flutter, back pain, blindness and low vision, bone cancer, bursitis, calculus of ureter, candidiasis, cellulitis and abscess of face, congenital anomalies of great vessels, congenital anomalies of limbs, corneal edema, cramp of limb, decreased libido, deep vein thrombosis, disorders of binocular eye movements, disorders of coccyx, disorders of lacrimal system, disorders of liver, displacement of intervertebral disc, dry eyes, edema, endometriosis, femoral hernia, generalized anxiety disorder, hallucinations, heart valve disorders, heart valve replaced, hereditary hemolytic anemias, hypertension complicating pregnancy, hypothyroidism, impetigo, infertility, female, inflammatory disease of breast, internal derangement of knee, intracranial hemorrhage (injury), iron metabolism disorder, keloid scar, leukoplakia of oral mucosa, mechanical complications of cardiac/vascular device, implant, and graft, mental retardation, multiple sclerosis, myocardial infarction, noninfectious disorders of lymphatic channels, open wound of foot except toe(s) alone, open wound of hand except finger(s), other disorders of gallbladder, other disorders of the nervous system, other local infections of skin and subcutaneous tissue, other rheumatic heart disease, other signs and symptoms in breast, ovarian dysfunction, peripheral retinal degenerations, poisoning by other anti-infectives, polycystic ovaries, portal hypertension, postlaminectomy syndrome, retinal edema and hypertensive retinopathy, spasm of muscle, streptococcus infection, subarachnoid hemorrhage (injury), substance addiction and disorders, superficial cellulitis and abscess, thoracic neuritis/radiculitis, unequal leg length (acquired), urethral stricture (not specified as infectious), urinary calculus, venous embolism & thrombosis, ventral hernia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood