rs7210405 chr17:78650421 G>A
- Sequence
tctgatgccacttctctatttacc[G/A]gagacaaacattcctgctttcaag
- ASB in cell types
- HepG2 (hepatoblastoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.91 | 0.12 | 1.98 | |||
| VCaP (prostate carcinoma) | -0.60 | 1.31 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, primary rhegmatogenous retinal detachment, relative telomere length, stabilized warfarin dose, tetrology of fallot
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Stomach, Testis, Thyroid