rs7214151 chr17:39351519 C>T
- Sequence
tatatttcagttgaatccaaactc[C/T]aggtttctcattcaaaaatataaa
- ASB in cell types
- pancreatic ductal adenocarcinoma
- ASB for transcription factors
- ELF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF3_HUMAN | 1.81 | -1.19 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, asthma, college completion, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, neuroblastoma (brain cancer), years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic