rs7217042 chr17:78176810 G>A
- Sequence
gtgcagtgtagggtgttgggctgc[G/A]tccctcgcccccacccattagata
- ASB in cell types
- KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | -2.39 | 2.20 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Pituitary, Whole_Blood