rs722317 chr11:15902016 G>A
- Sequence
aaggacaaggtgacatgcgccagt[G/A]ggccatttattcagcaaatattta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.20 | 1.58 | 2.03 | n/a | No Hit | |||
| FOXA1_HUMAN | -0.14 | 1.21 | 1.85 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, fasting blood glucose, hip bone mineral density (bmd), maternal transmission distortion, serum creatinine, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), transmission distortion