rs7224103 chr17:33512214 C>T
- Sequence
gataagggtgaaactctgcagtca[C/T]tatctatgctgaaagagaagcatc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.92 | -0.18 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, cognitive response to topiramate treatment as measured by the animals cognitive test, hdl cholesterol, hip bone mineral density (bmd), hypertriglyceridemia, irritible bowel syndrome, late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)