rs7227168 chr18:22933411 C>T
- Sequence
cagcccccggccttaaagcgcggg[C/T]tgtccggaggggtcggctttccca
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.21 | n/a | 2.50 | n/a | No Hit | |||
| ZFX_HUMAN | 1.44 | -0.76 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood