rs722729 chr11:117929089 C>T
- Sequence
agaccccaaatcccagcagcttct[C/T]ctcccaggggctttttctagaacc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- PBX1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | -2.17 | 1.80 | 1.50 | n/a | No Hit | |||
| GATA3_HUMAN | -1.59 | 2.04 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2