rs722731 chr1:230825373 T>G
- Sequence
ggggaaggaaagggcaccagagtt[T/G]gctttcgggctgctttgataatga
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.59 | 0.69 | 3.67 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.24 | 0.56 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Colon_Transverse, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Stomach, Thyroid