rs7229687 chr18:5456775 A>G
- Sequence
aatactgcgtgaacccacaatccc[A/G]gaaagccagtgctaatcctctttg
- ASB in cell types
- adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | -0.68 | 0.83 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Nerve_Tibial, Testis, Whole_Blood