rs723681 chr2:147910940 C>T
- Sequence
tgccatggtgtattatggtgcacg[C/T]acatagccaccagaaacatttttc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.16 | 0.47 | 1.80 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol change with statins, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), parkinsons disease, serum creatinine, total cholesterol, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood