rs7242481 chr18:36129254 G>A
- Sequence
gcgaacacgcggtggtttcattgg[G/A]ttggctgcccctcggtccgggggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells)
- ASB for transcription factors
- NRF1_HUMAN STAT1_HUMAN GLIS1_HUMAN PHF20_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 1.35 | -3.17 | 2.17 | n/a | No Hit | |||
| STAT1_HUMAN | 1.27 | -0.77 | 2.00 | n/a | No Hit | |||
| GLIS1_HUMAN | -3.16 | 2.32 | 2.00 | n/a | n/a | |||
| PHF20_HUMAN | 2.35 | n/a | 2.50 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, cystatin c in serum, rheumatoid arthritis, survival after esophageal squamous-cell carcinoma (esophageal cancer)
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood