rs7244505 chr18:5237868 C>T
- Sequence
gcagtcagattcctccgccgaccg[C/T]ggccctctctcctcgggctttgcc
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney) GM12878 (female B-cells) tibial nerve
- ASB for transcription factors
- CTCF_HUMAN FOXK2_HUMAN GABP1_HUMAN GABPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.42 | 0.34 | 1.24 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.77 | 0.34 | 1.33 | n/a | n/a | |||
| GABP1_HUMAN | n/a | 2.74 | 1.33 | n/a | n/a | |||
| GABPA_HUMAN | 0.02 | 1.73 | 1.44 | n/a | No Hit | |||
| CREB1_HUMAN | 0.67 | 1.18 | 1.39 | n/a | No Hit |
Items per page:
1 – 5 of 9
Motif analysis
No data available
Genetic associations
GRASP autism, birth weight, maternal transmission distortion, microalbuminuria, partial epilepsy, transmission distortion, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg