rs724617 chr2:215417758 G>A
- Sequence
tgttctcctttttaaagagtagga[G/A]taaggtcaacatgtaatactccaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.03 | -0.18 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), ldl cholesterol, tetrology of fallot, total cholesterol, total cholesterol change with statins, waist hip ratio