rs7248654 chr19:13156851 T>C
- Sequence
gctaggcaaggtggcaggcgcctg[T/C]aatcccagctatccgaaggctgag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | -0.30 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.62 | -0.24 | 1.98 | |||
| GM12878 (female B-cells) | 0.53 | 0.47 | 1.28 |
Items per page:
1 – 3 of 3