rs724915 chr6:17885120 G>A
- Sequence
tcaaagttgtgaagattcataaaa[G/A]aaaaaaaggaagagttaaacttca
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.83 | -1.66 | 1.33 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.35 | -0.71 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir, obesity (body mass index (bmi)), resistance to kuru in aged women despite likely exposure, total cholesterol, triglycerides, triglycerides change with statins