rs724922 chr5:4786152 G>A
- Sequence
gcagtgtgtgaggtaataaaggct[G/A]gaaattatggaaaattaatgaaag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 2.50 | n/a | 2.21 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), early reading ability, fasting blood glucose, hdl cholesterol, homa-ir, infant head circumference, obesity with early age of onset (age >2)