rs725030 chr4:86956139 A>G
- Sequence
ggaaataaggtttcctgcattttc[A/G]agtgaactagtttctggcctgatt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.71 | -0.18 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), college completion, gemcitabine-induced neutropenia/leukopenia in cancer patients, hdl cholesterol, ldl cholesterol, mitral annular calcium, triglycerides, years of education
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Thyroid