rs7252027 chr19:39540064 C>T
- Sequence
ctgtctgcgggacactgctgtctg[C/T]gggcagcttggacatctcagaccg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) HepG2 (hepatoblastoma)
- ASB for transcription factors
- NRF1_HUMAN EP300_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -0.26 | 1.53 | 1.75 | n/a | No Hit | |||
| EP300_HUMAN | -1.17 | 1.38 | 1.33 | n/a | n/a | |||
| FOXK2_HUMAN | 1.61 | -1.49 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol change with statins, ldl cholesterol, total cholesterol