rs725487 chr6:98961878 G>A
- Sequence
tgccgttatcacaggatgacttca[G/A]tcctctcttggcccttcttccttc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.16 | -0.43 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), diastolic blood pressure (dbp), ldl cholesterol, obesity with early age of onset (age >2), systolic blood pressure (sbp), total cholesterol
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood