rs7258875 chr19:28291955 C>T
- Sequence
caacctcctggttatatctatttc[C/T]ttcacactcctttctccctaagcc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.01 | -0.60 | 4.47 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi) in type 2 diabetes, diastolic blood pressure (dbp), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp)