rs726000 chr2:106990568 G>A
- Sequence
acactgcccatggctctaccccac[G/A]tttgtgaagagacctgatataaat
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.21 | 0.31 | 1.35 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP parkinsons disease, spine bone mineral density (bmd), systolic blood pressure (sbp), years of education
GTEx eQTL Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Testis