rs726179 chr6:119963209 A>C
- Sequence
tctctttttaaacatatcatgata[A/C]acttatcacatgatatcttgtatt
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.01 | 0.74 | 1.45 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, college completion, serum creatinine, triglycerides change with statins