rs72628299 chr16:87392650 A>G
- Sequence
gccccgtgagggacccaggccggg[A/G]ccgagccgggagggccaggggctg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.22 | 0.93 | 2.36 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.08 | 0.10 | 1.60 |
Items per page:
1 – 2 of 2