rs72635180 chr14:101005561 G>A
- Sequence
cttctcccagggagcaggcgctgg[G/A]tggaccctgacactggggagaatg
- ASB in cell types
- monocyte-derived macrophages CD34+ hematopoietic stem progenitor cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | 1.41 | n/a | 2.50 | |||
| CD34+ hematopoietic stem progenitor cells | -1.34 | 1.61 | 1.00 |
Items per page:
1 – 2 of 2