rs72638199 chr11:35485840 A>G
- Sequence
gctcttcagagacactcagaagga[A/G]gcgccttcaggataacgttgtctg
- ASB in cell types
- epidermal keratinocytes Delta47 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 1.79 | -1.48 | 2.00 | |||
| Delta47 (plasma cell myeloma) | 1.97 | -2.50 | 1.50 |
Items per page:
1 – 2 of 2