rs726418 chr17:72466267 G>A
- Sequence
cttaagcaatgctctgtttctaca[G/A]gcagctcccacttgtggaaaggca
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | -1.73 | 1.73 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, spine bone mineral density (bmd), stabilized warfarin dose, tetrology of fallot, triglycerides