rs72651387 chr4:75939885 T>C
- Sequence
caaagaggaagcgctggaggtttc[T/C]aggcaagcaggcaccgccctgttt
- ASB in cell types
- CD14+ monocytes periferal blood macrophages
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.01 | n/a | 2.50 | 1.12 | Weak Discordant | |||
| SPI1_HUMAN | 1.42 | 0.01 | 2.30 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid