rs726952 chr1:214808895 A>G
- Sequence
gctgaacacagattttggagactg[A/G]aggtgggaaagaatggaactgaga
- ASB in cell types
- foreskin keratinocyte LNCaP (prostate carcinoma) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.02 | -2.26 | 2.33 | |||
| LNCaP (prostate carcinoma) | -0.91 | 1.42 | 1.33 | |||
| bipolar neuron | -1.24 | 1.46 | 1.00 |
Items per page:
1 – 3 of 3