rs7269614 chr20:47205863 A>G
- Sequence
cagttttgcctatggccaccagat[A/G]gcgagcttgctggactgcatgaaa
- ASB in cell types
- SK-N-SH (neuroblastoma) epithelial cell of prostate foreskin keratinocyte T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.03 | 1.63 | 1.67 | 6.14 | Concordant | |||
| RAD21_HUMAN | -0.86 | 1.15 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, obesity with early age of onset (age >2), parkinsons disease