rs72697386 chr1:116737433 T>C
- Sequence
taaaagatgttctaaccagtgaaa[T/C]tgacaagagtgtggctcaggttgc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte HUES64 (embryonic stem cells) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 0.57 | 1.34 | |||
| foreskin keratinocyte | 0.40 | n/a | 2.33 | |||
| HUES64 (embryonic stem cells) | -0.44 | 1.22 | 1.33 | |||
| GM12878 (female B-cells) | 0.67 | 0.56 | 1.32 | |||
| erythroid progenitors | n/a | 2.23 | 2.50 |
Items per page:
1 – 5 of 5