rs72721018 chr14:67526957 A>G
- Sequence
aacaaggagaagtcctgaccatca[A/G]gggagataatagacctattggttc
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) epidermal keratinocytes CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.25 | 1.21 | 2.01 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.69 | 0.10 | 1.49 | |||
| epidermal keratinocytes | 1.79 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.10 | -1.79 | 2.00 | |||
| B-cells | 1.79 | n/a | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Atrial_Appendage, Muscle_Skeletal, Pituitary, Thyroid