rs72743329 chr15:73755837 T>C
- Sequence
actctgactactctaggtgcctca[T/C]ataagtggaatcacacagtctcac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.10 | 0.74 | 1.41 | |||
| HEK293 (embryonic kidney) | 0.47 | 0.44 | 1.36 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Testis