rs72791622 chr16:57520015 G>C
- Sequence
gctctgagcccccacactgcagtg[G/C]tggattcccttctctggagcctca
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) epidermal keratinocytes heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.31 | 0.83 | 2.15 | |||
| HepG2 (hepatoblastoma) | 0.71 | -0.14 | 1.98 | |||
| epidermal keratinocytes | 1.62 | -1.14 | 2.00 | |||
| heart left ventricle | 0.83 | -0.83 | 1.00 |
Items per page:
1 – 4 of 4