rs7281104 chr21:14546256 G>C
- Sequence
tgaaacattggatggctttctctt[G/C]agcattttgaattctgactactcc
- ASB in cell types
- GM12878 (female B-cells) CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.60 | 0.31 | 1.36 | |||
| CD34+ hematopoietic stem cells-derived proerythroblasts | -0.78 | 1.28 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, type 2 diabetes, end stage renal disease, type 2 diabetes, gender differentiated, waist hip ratio in controls